miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-134 | scaffold_3049935 | 7926 | 7903 | - |
| precursor | cro-NOVEL-134 | scaffold_3049935 | 7967 | 7903 | - |
Sequence and structure information
Mature sequence[cro-novel-134] ACUUUAGACCGAUCUGAUUUUCUC | |
Stem-loop sequence[cro-NOVEL-134] AAGAAAAUCGGAUCGGACCGACCAUCAUGACUUAGAAUCGAACUUUAGACCGAUCUGAUUUUCUC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 8.65 |
| seedling | MeJA treatment 1h | 5.2 |
| seedling | MeJA treatment 8h | 5.94 |
| seedling | MeJA treatment 24h | 12.67 |