miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-137 | scaffold_3064269 | 8070 | 8047 | - |
| precursor | cro-NOVEL-137 | scaffold_3064269 | 8115 | 8038 | - |
Sequence and structure information
Mature sequence[cro-novel-137] UCAGUCUGAUAGUGAGAUAUCUAC | |
Stem-loop sequence[cro-NOVEL-137] AGCCCUCUUUGUGUCUUUCUGUAGGGUUAACUUCUGUUAUUUUUUUCAGUCUGAUAGUGAGAUAUCUACUGAGCGGCA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 20.01 |
| seedling | MeJA treatment 1h | 21.56 |
| seedling | MeJA treatment 8h | 27.99 |
| seedling | MeJA treatment 24h | 14.98 |