miRNA detailed information
miRNA detail image
Location informaition
Type | ID | Scaffold | Start | End | Strand |
---|---|---|---|---|---|
mature | cro-novel-139 | scaffold_2977171 | 88 | 109 | + |
precursor | cro-NOVEL-139 | scaffold_2977171 | 32 | 110 | + |
Sequence and structure information
Mature sequence[cro-novel-139] CUUGCUCGUCUUCUAUUUCAAU | |
Stem-loop sequence[cro-NOVEL-139] CAUUGAAAUGGUGACAAGUAGGAAAUCACAUGCAUCAUUCUGUAAUGAAAUAUUACCUUGCUCGUCUUCUAUUUCAAUU | |
Secondary structure of stem-loop sequence
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRO_T007583 |
| hypothetical protein | 0 | psRNATarget[Detail] | |||||||||||||||
CRO_T028249 |
| hypothetical protein | 1.5 | psRNATarget[Detail] |
Expression pattern
Tissue | Treat | FPKM value |
---|---|---|
seedling | control | 61.07 |
seedling | MeJA treatment 1h | 17.22 |
seedling | MeJA treatment 8h | 7.78 |
seedling | MeJA treatment 24h | 77.59 |