miRNA detailed information
miRNA detail image
Location informaition
Type | ID | Scaffold | Start | End | Strand |
---|---|---|---|---|---|
mature | cro-novel-145 | scaffold_2953778 | 16568 | 16591 | + |
precursor | cro-NOVEL-145 | scaffold_2953778 | 16566 | 16634 | + |
Sequence and structure information
Mature sequence[cro-novel-145] GCUCGACGUCUAGGUAGAAGAUAU | |
Stem-loop sequence[cro-NOVEL-145] UUGCUCGACGUCUAGGUAGAAGAUAUAAAUCAUGGUAAUUCAGUUAUUUUCAAACUGGAGGUUAGGUAC | |
Secondary structure of stem-loop sequence
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRO_T025687 |
| hypothetical protein | 2.5 | psRNATarget[Detail] |
Expression pattern
Tissue | Treat | FPKM value |
---|---|---|
seedling | control | 50.29 |
seedling | MeJA treatment 1h | 49.22 |
seedling | MeJA treatment 8h | 41.89 |
seedling | MeJA treatment 24h | 45.04 |