miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-148 | scaffold_2964668 | 1394 | 1371 | - |
| precursor | cro-NOVEL-148 | scaffold_2964668 | 1399 | 1331 | - |
Sequence and structure information
Mature sequence[cro-novel-148] CUGGAUUUGGAUCUAUUUCACUAU | |
Stem-loop sequence[cro-NOVEL-148] AGGGUCUGGAUUUGGAUCUAUUUCACUAUAAGGUUCUAAGUUUUGGAAUAUUCGGAGGGUUUAGAUCCA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 6.27 |
| seedling | MeJA treatment 1h | 3.9 |
| seedling | MeJA treatment 8h | 5.02 |
| seedling | MeJA treatment 24h | 3.94 |