miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-15 | scaffold_3058938 | 4659 | 4636 | - |
| precursor | cro-NOVEL-15 | scaffold_3058938 | 4718 | 4528 | - |
Sequence and structure information
Mature sequence[cro-novel-15] AUCUUCGGAUUACUUGUAGUGCGA | |
Stem-loop sequence[cro-NOVEL-15] UCAUUUUGACAAAUUAAGAAUUUGUUGUUGGAAUUCGAUAAAUUUUAUUAGGUGACAUUAUCUUCGGAUUACUUGUAGUGCGAAGAUAAUGUUCGAAAAUGAAAUUUGAAGGUGGACAAGUAGUUCAAAAAUAAUGUUACAUGAUGAAAUUUGUCGGAUUUCGAUUACAAAUUUUUAAUUUGUCAAAGUGC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 23.11 |
| seedling | MeJA treatment 1h | 4.1 |
| seedling | MeJA treatment 8h | 18.31 |
| seedling | MeJA treatment 24h | 13.65 |