miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-150 | scaffold_3029210 | 12600 | 12623 | + |
| precursor | cro-NOVEL-150 | scaffold_3029210 | 12595 | 12707 | + |
Sequence and structure information
Mature sequence[cro-novel-150] AUUGAAUGUAGACGAAUGAAGAUU | |
Stem-loop sequence[cro-NOVEL-150] CGCACAUUGAAUGUAGACGAAUGAAGAUUAGUCUGAAUAUAAUAUGACUUAAAAUACCACCUAUAUAUACACAGAUUCACUCAUAAUUCCUCAUGGUCAGACAAAAAAGUGCA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 108.4 |
| seedling | MeJA treatment 1h | 90.75 |
| seedling | MeJA treatment 8h | 105.59 |
| seedling | MeJA treatment 24h | 97.17 |