miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-151 | scaffold_3063411 | 1397 | 1374 | - |
| precursor | cro-NOVEL-151 | scaffold_3063411 | 1420 | 1334 | - |
Sequence and structure information
Mature sequence[cro-novel-151] UGACGUGGGAUAUAAAAAGGGUUC | |
Stem-loop sequence[cro-NOVEL-151] UUGCGGUUUCUUUUUAACUUUAAUGACGUGGGAUAUAAAAAGGGUUCAGUUUUUACUAUUCUAAUUUUGUUCUUGUCGAGAUUGCAC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 5.53 |
| seedling | MeJA treatment 1h | 7.01 |
| seedling | MeJA treatment 8h | 6.08 |
| seedling | MeJA treatment 24h | 5.27 |