miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-152 | scaffold_1229224 | |||
| precursor | cro-NOVEL-152 |
Sequence and structure information
Mature sequence[cro-novel-152] UUAGGCUGUUGAUUUUUACUUC | |
Stem-loop sequence[cro-NOVEL-152] AGAUAGAAAGGAUUUUAGGCUGUUGAUUUUUACUUCUAAGGGCUGAUUCUAAAAACUAAUGCUAAAGAUUGAUGUCUAUCC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T002473 |
| hypothetical protein | 1.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T008075 |
| protein phosphatase X | 2.5 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 57.59 |
| seedling | MeJA treatment 1h | 52.3 |
| seedling | MeJA treatment 8h | 48.29 |
| seedling | MeJA treatment 24h | 67.97 |