miRNA detailed information
miRNA detail image
Location informaition
Type | ID | Scaffold | Start | End | Strand |
---|
mature | cro-novel-155 | scaffold_3000226 | 12034 | 12057 | + |
precursor | cro-NOVEL-155 | scaffold_3000226 | 11974 | 12057 | + |
Sequence and structure information
Mature sequence[cro-novel-155] AGAAGUGUAUUAAACGAUCCUGAG |
Stem-loop sequence[cro-NOVEL-155] AUCGGUAUCUUUUAGUACAUCUUUUAGCAUAAAUAAAUCCUAAAACUCUAAAAGGUAAAAAGAAGUGUAUUAAACGAUCCUGAG |
Secondary structure of stem-loop sequence
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
Target gene | Alignment | Annotation | Expection | Method |
---|
CRO_T011662 | | ncRNA: | 24 | GAGUCCUAGCAAAUUAUGUGAAGA | 1 | | | | |||--||*|||||||||=|||||| | | | targets: | 1829 | CUC--GAGCGUUUAAUAUACUUCU | 1850 |
| XB3 ortholog 1 in Arabidopsis thaliana | 2.5 | psRNATarget[Detail] | CRO_T022171 | | ncRNA: | 24 | GAGUCCUAGCAAAUUAUGU-GAAGA | 1 | | | | |||**||||||||||||||-||||| | | | targets: | 14139 | CUCUAGAUCGUUUAAUACAUCUUCU | 14163 |
| cytochrome P450, family 81, subfamily H, polypeptide | 3 | psRNATarget[Detail] | CRO_T023667 | | ncRNA: | 24 | GAGUCCUAGCAAAUUAUGUGAAGA | 1 | | | | **||*|||||||||||||||||=| | | | targets: | 3862 | GCCAAGAUCGUUUAAUACACUUUU | 3885 |
| hypothetical protein | 1.5 | psRNATarget[Detail] | CRO_T026111 | | ncRNA: | 24 | GAGUCCUAGCAAAUUAUGUGA-AGA | 1 | | | | =|=||||||||||||||||||-||| | | | targets: | 9246 | UUUAGGAUCGUUUAAUACACUCUCU | 9270 |
| DUF4079 domain containing protein | 3 | psRNATarget[Detail] | CRO_T031304 | | ncRNA: | 24 | GAGUCCUAGCAAAUUAUGUGAAGA | 1 | | | | ||||*||||*|||||||||=|||| | | | targets: | 3665 | CUCAAGAUCAUUUAAUACAUUUCU | 3688 |
| nodulin MtN21 /EamA-like transporter family protein | 2.5 | psRNATarget[Detail] | CRO_T032765 | | ncRNA: | 24 | GAGUCCUAGCAAAUUAUGUGAAGA | 1 | | | | ||---|||||||||||||||||** | | | targets: | 4256 | CU---GAUCGUUUAAUACACUUAG | 4276 |
| SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein | 2.5 | psRNATarget[Detail] |
|
Expression pattern
Tissue | Treat | FPKM value |
---|
seedling | control | 26.67 |
seedling | MeJA treatment 1h | 25.24 |
seedling | MeJA treatment 8h | 9.67 |
seedling | MeJA treatment 24h | 33.16 |