miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-16 | scaffold_3037942 | 15532 | 15555 | + |
| precursor | cro-NOVEL-16 | scaffold_3037942 | 15664 | 15518 | - |
Sequence and structure information
Mature sequence[cro-novel-16] UCCUCUAAUCUCUGGUAUGACAUU | |
Stem-loop sequence[cro-NOVEL-16] UUUCAUCAAUUCCUUCCUCUAAUCUCUGGUAUGACAUUCUUAGGUUCCCUGUCGGAUGUGUAACACUGACACAAUCUUAGAUGGUAUGGUGCCUUCUCUUAAAGGGUAGAAUGUCAUACCAGAGAUUAGAGGAAGGAAUUGAUGAAU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T008205 |
| ARID/BRIGHT DNA-binding domain-containing protein | 0 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 33.91 |
| seedling | MeJA treatment 1h | 29 |
| seedling | MeJA treatment 8h | 15.55 |
| seedling | MeJA treatment 24h | 39.19 |