miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-163 | scaffold_3069441 | 33953 | 33976 | + |
| precursor | cro-NOVEL-163 | scaffold_3069441 | 33917 | 33978 | + |
Sequence and structure information
Mature sequence[cro-novel-163] AAUUACUCCUUAUAGGUUGGACGU | |
Stem-loop sequence[cro-NOVEL-163] AAAUGAUCAGCCUGAACGUGAAUGAUUAAAGAAAAUAAUUACUCCUUAUAGGUUGGACGUUC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 3.52 |
| seedling | MeJA treatment 1h | 2.46 |
| seedling | MeJA treatment 8h | 2.2 |
| seedling | MeJA treatment 24h | 2.76 |