miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-17 | scaffold_3026526 | 6311 | 6334 | + |
| precursor | cro-NOVEL-17 | scaffold_3026526 | 6147 | 6344 | + |
Sequence and structure information
Mature sequence[cro-novel-17] AGACGACUUUGGGAUAUAAUGCGA | |
Stem-loop sequence[cro-NOVEL-17] GUUACUUAAGUCGCAUUAUAACCGAAGUCAUUUUUUUUUCCCUUAACUUAAAAUCAUUUGUCAAAAAGUAAUUUACCACAUGCAUCUUUUUUUGCGGGCUCCACCGGGUUAGUGGUGGCAUGCCACUUUUUGAUACGAUUUUAAUUUAAGGGUAAAAAGACAAAAGACGACUUUGGGAUAUAAUGCGAUUUAAGUAAA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 6.49 |
| seedling | MeJA treatment 1h | 4.36 |
| seedling | MeJA treatment 8h | 5.24 |
| seedling | MeJA treatment 24h | 5.82 |