miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-170 | scaffold_3070265 | 67309 | 67332 | + |
| precursor | cro-NOVEL-170 | scaffold_3070265 | 67302 | 67367 | + |
Sequence and structure information
Mature sequence[cro-novel-170] AUAAAGAUCUACUUGCAUUACUGU | |
Stem-loop sequence[cro-NOVEL-170] GUAAUAAAUAAAGAUCUACUUGCAUUACUGUACUCAUCGUAUUGAAGUAAAUUGAUUAAUUGUUAG | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T012891 |
| FTSH protease | 2 | psRNATarget[Detail] | |||||||||||||||
| CRO_T016489 |
| basic leucine-zipper | 1 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 20.02 |
| seedling | MeJA treatment 1h | 13.01 |
| seedling | MeJA treatment 8h | 13.13 |
| seedling | MeJA treatment 24h | 13.12 |