miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-172 | scaffold_3061314 | 5792 | 5769 | - |
| precursor | cro-NOVEL-172 | scaffold_3061314 | 5832 | 5769 | - |
Sequence and structure information
Mature sequence[cro-novel-172] UUAGGUAAGUGCUUUAGAAAUAUA | |
Stem-loop sequence[cro-NOVEL-172] UGUAUUUUUGCGUAUCCUCUUAUUUUGAAAAAAUGGAAACUUAGGUAAGUGCUUUAGAAAUAUA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 14.11 |
| seedling | MeJA treatment 1h | 16.92 |
| seedling | MeJA treatment 8h | 10.37 |
| seedling | MeJA treatment 24h | 10.03 |