miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-22 | scaffold_3053446 | 12737 | 12717 | - |
| precursor | cro-NOVEL-22 | scaffold_3053446 | 12744 | 12622 | - |
Sequence and structure information
Mature sequence[cro-novel-22] UUACGCCUUGACGCGAGUAGG | |
Stem-loop sequence[cro-NOVEL-22] AUUUGAGUUACGCCUUGACGCGAGUAGGGAUAUCCUGCGUCAAGUUUUGGCUUAGACAAUGAGAGAAUCGUGCUAAUGCCUGAUGCAGGGAUACCCCUACUCACGUCGGGGCGUGGCUCAAGU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 12.54 |
| seedling | MeJA treatment 1h | 7.83 |
| seedling | MeJA treatment 8h | 2 |
| seedling | MeJA treatment 24h | 3.79 |