miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-24 | scaffold_2977869 | 2065 | 2088 | + |
| precursor | cro-NOVEL-24 | scaffold_2977869 | 2060 | 2249 | + |
Sequence and structure information
Mature sequence[cro-novel-24] UUCUAUUAUGGACUCUAUACAUGU | |
Stem-loop sequence[cro-NOVEL-24] UAAAAUUCUAUUAUGGACUCUAUACAUGUCUCUAUUCAUGGACUAUGUGAUUUGUAUUAAAUCACAUCACCUUUAUAGUUAUUUUUGUCUCAAUAAUAUGAGAUAUAAUUAAUAACAGAACGUGAUGUGAUAAACACAUGCCAUAUAAUAUAUGAAUUGAGAUAUGGACUGAGUUCAUAAUAGAAUUUUC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T001299 |
| Seven transmembrane MLO family protein | 2 | psRNATarget[Detail] | |||||||||||||||
| CRO_T015251 |
| beta-xylosidase | 3 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 4.4 |
| seedling | MeJA treatment 1h | 4.05 |
| seedling | MeJA treatment 8h | 3.83 |
| seedling | MeJA treatment 24h | 2.43 |