miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-25 | scaffold_3018783 | 20596 | 20619 | + |
| precursor | cro-NOVEL-25 | scaffold_3018783 | 20580 | 20750 | + |
Sequence and structure information
Mature sequence[cro-novel-25] CUAUUUUCGUGCGUCUAUAACUAU | |
Stem-loop sequence[cro-NOVEL-25] UUUUUAUAUGCCUAAACUAUUUUCGUGCGUCUAUAACUAUCUGAUACUAUAUUCCGUGGUGUAAUCCAGCCAACAUUCUCACGUGACUCAUGUGGAUUUGGUUGAAUUCCGAUGCGAAAUGUGAUGUCAAGACAGUUUUAGAUGUACGAAAAUAGUUUGAGUAUGUAAAAU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 6.85 |
| seedling | MeJA treatment 1h | 6.84 |
| seedling | MeJA treatment 8h | 10.5 |
| seedling | MeJA treatment 24h | 10.93 |