miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-28 | scaffold_3068885 | 10275 | 10298 | + |
| precursor | cro-NOVEL-28 | scaffold_3068885 | 10176 | 10308 | + |
Sequence and structure information
Mature sequence[cro-novel-28] AUCUACUCGUGCCAAGACGUGACU | |
Stem-loop sequence[cro-NOVEL-28] GACCUAUUUGAGCAACGUCUUGGCGCAAGUAGGAGUGACCACACGCUAGGGAUUGACGCUGACCUUGAGAUGAUCCUGUCAGUCAUUGGCGCGGAACACAUCUACUCGUGCCAAGACGUGACUCAAGUGGGUA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 4.97 |
| seedling | MeJA treatment 1h | 3.89 |
| seedling | MeJA treatment 8h | 4.7 |
| seedling | MeJA treatment 24h | 4.13 |