miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-35 | scaffold_2999703 | 18568 | 18591 | + |
| precursor | cro-NOVEL-35 | scaffold_2999703 | 18404 | 18594 | + |
Sequence and structure information
Mature sequence[cro-novel-35] ACGGAUCUGUUCUAUAAAAGAAUU | |
Stem-loop sequence[cro-NOVEL-35] AAAAAUUUUAUUAUGGAUAAGGUUCAUCUCCUAUCUUAUGGACCUUUUAGCUUGUAGUAAGGUACAUCAUCCCUCCUUGGAAUUCUUGUUUCCGUAACUGAAGAUAUGAUGAACAAGAAUAUUGAUGUAACUUAAUACAAAGCAAGAAGUCUAUGAGUAGAGAUACGGAUCUGUUCUAUAAAAGAAUUUUC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 17.29 |
| seedling | MeJA treatment 1h | 15.12 |
| seedling | MeJA treatment 8h | 11.61 |
| seedling | MeJA treatment 24h | 6.14 |