miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-4 | scaffold_1263261 | |||
| precursor | cro-NOVEL-4 |
Sequence and structure information
Mature sequence[cro-novel-4] UAGAGAUAUGUACUUCGAGGUG | |
Stem-loop sequence[cro-NOVEL-4] UCUUCAUAAGUUGGACACACCUCGAAGUACAUAUCUCUACUUCUCUCUCAUUCUCUCUUGUAUUAUAAUUUUGCUGAUCAAUAAGAAGAAGGCAAAGGAUGUUGUUAAGAUCCUGAUUUGUCCGAUCGAGAUAAGAAUCUAUGCAUAAUUAUAAUACAAGAGAGAAUGAGAGAGAAGUAGAGAUAUGUACUUCGAGGUGUGUCCAACUUAUGAAGA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 4.88 |
| seedling | MeJA treatment 1h | 20.16 |
| seedling | MeJA treatment 8h | 24.17 |
| seedling | MeJA treatment 24h | 2.77 |