miRNA detailed information
miRNA detail image
Location informaition
Type | ID | Scaffold | Start | End | Strand |
---|
mature | cro-novel-42 | scaffold_3060104 | 3351 | 3328 | - |
precursor | cro-NOVEL-42 | scaffold_3060104 | 3366 | 3160 | - |
Sequence and structure information
Mature sequence[cro-novel-42] GAUUCUCUGUACCACUUUGUGUAC |
Stem-loop sequence[cro-NOVEL-42] UAUAUUUGGAUACAAGAUUCUCUGUACCACUUUGUGUACUGCUUAUGUACCACUUUCCUUUUAUAAUAUAUUUUCCCUUUAGGUUUUAUCUUUUUAUCUUAGAGUUUAUCUUUUAUUUAUUAGGUUUUAUUAAUAAAAUAUACCAAAUUAGAAAGUGUUAUGGAGAGUGGUACACAAAGUGGUAUAGGAGAUCCGAACCCAUAUAUU |
Secondary structure of stem-loop sequence
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
Target gene | Alignment | Annotation | Expection | Method |
---|
CRO_T001584 | | ncRNA: | 24 | CAUGUGUUUCACCAUGUCUCUUAG | 1 | | | | |||||||*|*|||||||||||||| | | | targets: | 2894 | GUACACACAAUGGUACAGAGAAUC | 2917 |
| type one serine/threonine protein phosphatase | 2 | psRNATarget[Detail] | CRO_T002883 | | ncRNA: | 24 | CAUGUGUUUCACCAUGUCUCUUAG | 1 | | | | ||||||||||||||||||||=||| | | | targets: | 1234 | GUACACAAAGUGGUACAGAGGAUC | 1257 |
| cytochrome P450, family 71, subfamily B, polypeptide | 1.5 | psRNATarget[Detail] | CRO_T020015 | | ncRNA: | 24 | CAUGUGUUUCACCAUGUCUCUUAG | 1 | | | | *||=|=|||||||||||||||||| | | | targets: | 5824 | UUAUAUAAAGUGGUACAGAGAAUC | 5847 |
| Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein | 1 | psRNATarget[Detail] | CRO_T022252 | | ncRNA: | 24 | CAUGUGUUUCACCAUGUCUCUUAG | 1 | | | | ||||||*|||||||||||||=||| | | | targets: | 7874 | GUACACCAAGUGGUACAGAGGAUC | 7897 |
| phosphatidylinositol 4-OH kinase beta1 | 2.5 | psRNATarget[Detail] | CRO_T029531 | | ncRNA: | 24 | CAUGUGUUUCACCAUGUCUCUUAG | 1 | | | | ||||||||||||||||||||*||= | | | targets: | 11513 | GUACACAAAGUGGUACAGAGUAUU | 11536 |
| Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase family protein | 2.5 | psRNATarget[Detail] |
|
Expression pattern
Tissue | Treat | FPKM value |
---|
seedling | control | 37.52 |
seedling | MeJA treatment 1h | 38.16 |
seedling | MeJA treatment 8h | 46 |
seedling | MeJA treatment 24h | 31.77 |