miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-44 | scaffold_2978040 | 52801 | 52782 | - |
| precursor | cro-NOVEL-44 | scaffold_2978040 | 52819 | 52693 | - |
Sequence and structure information
Mature sequence[cro-novel-44] UUCUCCCUCAAGGGCUUCCC | |
Stem-loop sequence[cro-NOVEL-44] CCAAGGCAUUGGUUGUUCUUCUCCCUCAAGGGCUUCCCUAUAUAUUAUGGGCAUACUGCUACUUUGCUUGCUUAUAAUAAGGUUAGAGAGGAGCCCUUGUCGGGGAAACAACAGCCCCAUGUCUUGC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T016544 |
| RGA-like | 1.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T027657 |
| ATPase family associated with various cellular activities (AAA) | 2.5 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 14.04 |
| seedling | MeJA treatment 1h | 10.79 |
| seedling | MeJA treatment 8h | 8.83 |
| seedling | MeJA treatment 24h | 18.53 |