miRNA detailed information
miRNA detail image
Location informaition
Type | ID | Scaffold | Start | End | Strand |
---|---|---|---|---|---|
mature | cro-novel-46 | scaffold_3038029 | 33705 | 33682 | - |
precursor | cro-NOVEL-46 | scaffold_3038029 | 33714 | 33556 | - |
Sequence and structure information
Mature sequence[cro-novel-46] UUGGACCACAUUAAAUCAUAUUAU | |
Stem-loop sequence[cro-NOVEL-46] AUGGAUUUCUUGGACCACAUUAAAUCAUAUUAUUUAUGCAUGUAGUCAGUGUUUUGGAUUAAGUGACUAAAUUAGACCUCCACUUAUGAAGAUUCAAGGUGUUAUAUUACACAACAACAUGAAUGAAUAAUGUGGUUUAAUAUGGUUCAAGAGGUUCAC | |
Secondary structure of stem-loop sequence
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
Tissue | Treat | FPKM value |
---|---|---|
seedling | control | 12.26 |
seedling | MeJA treatment 1h | 13.68 |
seedling | MeJA treatment 8h | 26.88 |
seedling | MeJA treatment 24h | 6.57 |