miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-52 | scaffold_3051709 | 46074 | 46094 | + |
| precursor | cro-NOVEL-52 | scaffold_3051709 | 46006 | 46099 | + |
Sequence and structure information
Mature sequence[cro-novel-52] UUCUACUGUGAAAUUUGGUGU | |
Stem-loop sequence[cro-NOVEL-52] UUCCGGCAUCACAUUUUGCGGUAGAAUUUGGCCAAAACCACAUGAGCCAUGUGAGGGUUUUAGCCGGAUUCUACUGUGAAAUUUGGUGUCGGGU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 184.38 |
| seedling | MeJA treatment 1h | 4.5 |
| seedling | MeJA treatment 8h | 98.4 |
| seedling | MeJA treatment 24h | 338.82 |