miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-56 | scaffold_3059977 | 48514 | 48537 | + |
| precursor | cro-NOVEL-56 | scaffold_3059977 | 48382 | 48539 | + |
Sequence and structure information
Mature sequence[cro-novel-56] AGAAUUGCUGAAUCACCAUGAUUU | |
Stem-loop sequence[cro-NOVEL-56] AUGGAUUAUGGAGAUGCAGAGUUGGUACCAACGUUCAAGGUUCAAAUACUGGUAGCAGCAGCGUAGGAAUUUCAACUUCUCCAAUGUGAGGGGUGGUUCCUUGUACGCACCAGUGUCUGGCCUCCCGUCUGCAGAAUUGCUGAAUCACCAUGAUUUAC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 50.38 |
| seedling | MeJA treatment 1h | 83.14 |
| seedling | MeJA treatment 8h | 54.48 |
| seedling | MeJA treatment 24h | 24.04 |