miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-63 | scaffold_3064339 | 48099 | 48076 | - |
| precursor | cro-NOVEL-63 | scaffold_3064339 | 48113 | 48023 | - |
Sequence and structure information
Mature sequence[cro-novel-63] ACCUAGAAUCGUCUGUAACAUUCU | |
Stem-loop sequence[cro-NOVEL-63] UUAUAUAUAUAUACACCUAGAAUCGUCUGUAACAUUCUCUGUAGUGUUAUAGAGAAUGUUACAGACGAUUUAAACUGAUAUAUAUAUAUAU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T006606 |
| alpha carbonic anhydrase | 0 | psRNATarget[Detail] | |||||||||||||||
| CRO_T017276 |
| amino acid permease | 2.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T025815 |
| Aluminium induced protein with YGL and LRDR motifs | 3 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 40.12 |
| seedling | MeJA treatment 1h | 59.75 |
| seedling | MeJA treatment 8h | 50.92 |
| seedling | MeJA treatment 24h | 49.04 |