miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-64 | scaffold_3053952 | 528 | 505 | - |
| precursor | cro-NOVEL-64 | scaffold_3053952 | 538 | 406 | - |
Sequence and structure information
Mature sequence[cro-novel-64] AUGACUGUUUGUUAUCGCCAGAUC | |
Stem-loop sequence[cro-NOVEL-64] AUAACGCACAAUGACUGUUUGUUAUCGCCAGAUCAGCGCCAGAUAAGAGCCACUCAGUUUUUUACGCAAUUAGCGCGGCUGAACGCGGCUUAAGCCGCAUGAUUAGGGAUAACGCACAAUGACUGUGCGUUAU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T027441 |
| hypothetical protein | 2.5 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 55.44 |
| seedling | MeJA treatment 1h | 5.14 |
| seedling | MeJA treatment 8h | 25.75 |
| seedling | MeJA treatment 24h | 34.1 |