miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-65 | scaffold_3002661 | 12021 | 12044 | + |
| precursor | cro-NOVEL-65 | scaffold_3002661 | 11932 | 12045 | + |
Sequence and structure information
Mature sequence[cro-novel-65] AUGUGGGUCCGGGAUUAGUGCUCC | |
Stem-loop sequence[cro-NOVEL-65] AGGAGCACUAUUACUGAGCUCACAACAUCAGGUAGAAAAUUUGAAAAGUAGAAGUCAGAUGAAGGGGGUUGGAACUGUGAAGCCUGAUGAUGUGGGUCCGGGAUUAGUGCUCCA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 29.62 |
| seedling | MeJA treatment 1h | 31.13 |
| seedling | MeJA treatment 8h | 25.84 |
| seedling | MeJA treatment 24h | 24.13 |