miRNA detailed information
miRNA detail image
Location informaition
Type | ID | Scaffold | Start | End | Strand |
---|
mature | cro-novel-7 | scaffold_3028620 | 6235 | 6212 | - |
precursor | cro-NOVEL-7 | scaffold_3028620 | 6286 | 5946 | - |
Sequence and structure information
Mature sequence[cro-novel-7] AUCCUCUGUAAUAUUUCUUGUAAC |
Stem-loop sequence[cro-NOVEL-7] CUUCUUUUGUAAUAUGUUUUUCUUUUUAAGGUUUACUUUUUUUCAGUUCGAAUCCUCUGUAAUAUUUCUUGUAACAUUCUUGAUUUGGUAUAUUUUAUUAAUAAAACUUACCAAAUAAAAGAUAAACUUAAGAGGAAAAUGUAAACUUUGAAGGGAAAAACAUAUUAUAAAAGGAAAUAUUACAAAAACAAACGAUCUUGAGUGCCUUUUUCUCUUAAGAUUUAUCUUUUACUUGGUAAGUUUUAUUAAUAAGUAUACCAAAUUAAGAAUGUUACCGGAAAUGUUACAAGACAAUGAAAUAGUGAAAUGUACUUAAAUUACAUUGCAUAUUGUAAGGGAAA |
Secondary structure of stem-loop sequence
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
Target gene | Alignment | Annotation | Expection | Method |
---|
CRO_T007160 | | ncRNA: | 24 | CAAUGUUCUUUAUAAUGUCUCCUA | 1 | | | | |||||||*||||=||||||||||| | | | targets: | 8821 | GUUACAAAAAAUGUUACAGAGGAU | 8844 |
| 10-formyltetrahydrofolate synthetase | 2.5 | psRNATarget[Detail] | CRO_T009769 | | ncRNA: | 24 | CAAUGUUCUUUAUAAUGUCUCCUA | 1 | | | | |||||=|||||||||||||||*|| | | | targets: | 2322 | GUUACGAGAAAUAUUACAGAGAAU | 2345 |
| CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily pr | 2.5 | psRNATarget[Detail] | CRO_T020935 | | ncRNA: | 24 | CAAUGUUCUUUAUAAUGUCUCCUA | 1 | | | | ||||*|=|||||||||||*||||| | | | targets: | 12150 | GUUAAAGGAAAUAUUACAUAGGAU | 12173 |
| golgin candidate | 2.5 | psRNATarget[Detail] | CRO_T031150 | | ncRNA: | 24 | CAAUGUUCUUUAUAAUGUCUCCUA | 1 | | | | ||||||**|||||||||||||||| | | | targets: | 2403 | GUUACAUAAAAUAUUACAGAGGAU | 2426 |
| Nodulin MtN3 family protein | 2 | psRNATarget[Detail] | CRO_T033107 | | ncRNA: | 24 | CAAUGUUCUUUAUAAUGUCUCCUA | 1 | | | | ||||*||||||||||||||||||| | | | targets: | 6389 | GUUAAAAGAAAUAUUACAGAGGAU | 6412 |
| aminophospholipid ATPase | 0 | psRNATarget[Detail] |
|
Expression pattern
Tissue | Treat | FPKM value |
---|
seedling | control | 16.29 |
seedling | MeJA treatment 1h | 12.05 |
seedling | MeJA treatment 8h | 16.52 |
seedling | MeJA treatment 24h | 25.85 |