miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-72 | scaffold_2956010 | 12529 | 12550 | + |
| precursor | cro-NOVEL-72 | scaffold_2956010 | 12523 | 12599 | + |
Sequence and structure information
Mature sequence[cro-novel-72] UGGUGCACAGGAGGACGUCGUA | |
Stem-loop sequence[cro-NOVEL-72] CGAUCAUGGUGCACAGGAGGACGUCGUAAUUGCUAUCUCGGAAGCACAUCUCCGGCGUCCUCUUUGCACCAUGAUUA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 80.51 |
| seedling | MeJA treatment 1h | 97.73 |
| seedling | MeJA treatment 8h | 110.04 |
| seedling | MeJA treatment 24h | 87.43 |