miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-74 | scaffold_3025104 | 19073 | 19096 | + |
| precursor | cro-NOVEL-74 | scaffold_3025104 | 19061 | 19306 | + |
Sequence and structure information
Mature sequence[cro-novel-74] AUCUUCGGUCUGAAAUAUAAGUUU | |
Stem-loop sequence[cro-NOVEL-74] AAACUAUAUAUUAUCUUCGGUCUGAAAUAUAAGUUUUUUUAAUCAAAAUUAUAAGUCUUUUUAUACAUUUCAAUGUGUAUUUAUUAUCUAUUUUCCAACUCUAUCCUCUUUUAAUUCAUCUAUUUACCUCUCUUCCUUUCUUUCUCUUUCCUUAUUUAUUGAGGUACCUUAAAAAUUAUAUUAUUUCUUCAUCCUUAAUUCGUGUGUAAAAAGACUUAUAUUCUUGAUCGAAAGUAGUAUAAGUUA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T014800 |
| DNA/RNA polymerases superfamily protein | 1.5 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 33.98 |
| seedling | MeJA treatment 1h | 29.46 |
| seedling | MeJA treatment 8h | 29.61 |
| seedling | MeJA treatment 24h | 15.38 |