miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-79 | scaffold_3005365 | 10439 | 10459 | + |
| precursor | cro-NOVEL-79 | scaffold_3005365 | 10381 | 10460 | + |
Sequence and structure information
Mature sequence[cro-novel-79] UAGUAAAACAAAGGUAGGGUG | |
Stem-loop sequence[cro-NOVEL-79] UUACCCUACCUUUGUGUUACUAUCUUUUUUUAUUUAUUUUGUAUGGAAAGAAAAAUGAUAGUAAAACAAAGGUAGGGUGC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T009472 |
| B-block binding subunit of TFIIIC | 3 | psRNATarget[Detail] | |||||||||||||||
| CRO_T014217 |
| Calcineurin-like metallo-phosphoesterase superfamily protein | 1.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T033573 |
| hypothetical protein | 2 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 4.59 |
| seedling | MeJA treatment 1h | 5.7 |
| seedling | MeJA treatment 8h | 4.39 |
| seedling | MeJA treatment 24h | 6.1 |