miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-9 | scaffold_2998190 | 5608 | 5588 | - |
| precursor | cro-NOVEL-9 | scaffold_2998190 | 5646 | 5456 | - |
Sequence and structure information
Mature sequence[cro-novel-9] UCCGGCUGCUUCUUUCAUGUG | |
Stem-loop sequence[cro-NOVEL-9] GUAGCUGAAAAUAUCAAUUUAUCACCUAGAAGGCGGAAUCCGGCUGCUUCUUUCAUGUGAAACGCACGUGUACGCCAUGUGCAACCGUUCUUAUUGACAUAGGUACCACUCACACCAGCUGCACGUGCGUUUCACAUGAAAGAAACAGCUGAAUUUCGUCUUUUAGCUGAUAAAUUGAUAUUAUCAGCUAG | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T022192 |
| polyol/monosaccharide transporter | 2 | psRNATarget[Detail] | |||||||||||||||
| CRO_T027631 |
| proteolysis | 2.5 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 7.74 |
| seedling | MeJA treatment 1h | 4.16 |
| seedling | MeJA treatment 8h | 3.28 |
| seedling | MeJA treatment 24h | 7.22 |