miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-90 | scaffold_3054271 | 5850 | 5827 | - |
| precursor | cro-NOVEL-90 | scaffold_3054271 | 5994 | 5818 | - |
Sequence and structure information
Mature sequence[cro-novel-90] AACCGGACGUACUAUAUUCUUGAU | |
Stem-loop sequence[cro-NOVEL-90] AUGAGGAAAGAGAGAGAUAGUGGGAGUGAAAUAAAUAUAUAGAAAGGCGGGUAAAGAUGAAAGAUUCAAUAAAUACUUAUUGAAAAUUGUAAAAAUUUUUAUAUUUUUAACCAUUCUCAAUGAGUCUAAAACCUUUAUAUUUUCAACCGGACGUACUAUAUUCUUGAUCAUCCUUAA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 5.16 |
| seedling | MeJA treatment 1h | 5.11 |
| seedling | MeJA treatment 8h | 4.29 |
| seedling | MeJA treatment 24h | 4.74 |