miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-91 | scaffold_3016797 | 6038 | 6061 | + |
| precursor | cro-NOVEL-91 | scaffold_3016797 | 6026 | 6117 | + |
Sequence and structure information
Mature sequence[cro-novel-91] GUCUGGCCUUCAGUCUGUAGAGUC | |
Stem-loop sequence[cro-NOVEL-91] ACUUGCAUCAGUGUCUGGCCUUCAGUCUGUAGAGUCGCUGAGUCACCAUGAUUUACAUCUUGCACCUGAGCGUUGGACAGUCUGGUGGGGGC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T026010 |
| zinc ion binding;nucleic acid binding | 2 | psRNATarget[Detail] | |||||||||||||||
| CRO_T030434 |
| FAD/NAD(P)-binding oxidoreductase family protein | 1 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 79.83 |
| seedling | MeJA treatment 1h | 70.82 |
| seedling | MeJA treatment 8h | 67.72 |
| seedling | MeJA treatment 24h | 65.74 |