miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-94 | scaffold_2966372 | 8634 | 8657 | + |
| precursor | cro-NOVEL-94 | scaffold_2966372 | 8518 | 8673 | + |
Sequence and structure information
Mature sequence[cro-novel-94] AAGUUCUGGAUUCGAAUCACAUCU | |
Stem-loop sequence[cro-NOVEL-94] AUGAUAUAUAAAGUAAUAUACAUGAUUCGAACCGAACUAGUAAAUAUGCAUAAACGAGUUUCAAUGUGCAUGGUAAGGUGAUAGCUCACUACUAAAAACGUAUGUUAUUAAGUUACAAGUUCUGGAUUCGAAUCACAUCUCAUCCUUCAAUAUUAA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 22.07 |
| seedling | MeJA treatment 1h | 15.62 |
| seedling | MeJA treatment 8h | 23.13 |
| seedling | MeJA treatment 24h | 14.56 |