miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-97 | scaffold_3062939 | 58386 | 58409 | + |
| precursor | cro-NOVEL-97 | scaffold_3062939 | 58321 | 58413 | + |
Sequence and structure information
Mature sequence[cro-novel-97] ACCUGUGAAUUGCUCACGAGCAAC | |
Stem-loop sequence[cro-NOVEL-97] UCGUUUGCCAGUGAGUCGACUCGAGCUCGGUCAAUAGUAAACUCAAACCAAGUUUUGACCGAGCAACCUGUGAAUUGCUCACGAGCAACUCGC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 2.23 |
| seedling | MeJA treatment 1h | 1.14 |
| seedling | MeJA treatment 8h | 1.51 |
| seedling | MeJA treatment 24h | 1.76 |