cro-novel-158's details annotation
|
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein |
| This network produced by cytoscapeweb
|
Module annotation (GSEA enrichment result)
| Function Annotation | FDR | Gene Ontolog |
|---|
| apoplast | 0.017254367 | GO:0048046 |
| cytoskeleton organization | 0.028949928 | GO:0007010 |
| lignin catabolic process | 0.031292983 | GO:0046274 |
| single-organism process | 0.031292983 | GO:0044699 |
| response to biotic stimulus | 0.031292983 | GO:0009607 |
| oxidoreductase activity, oxidizing metal ions | 0.049324096 | GO:0016722 |
| microtubule binding | 0.049324096 | GO:0008017 |
| hydroquinone:oxygen oxidoreductase activity | 0.049324096 | GO:0052716 |
| Transcription_related, Transcription factor: ERF | 0.024832496 | gene family |
| Transcription_related, Transcription factor: WRKY | 0.024832496 | gene family |
| 5-deoxystrigol biosynthesis | 0.001240768 | plantCyc |
| Carotenoid biosynthesis | 0.005838109 | KEGG |
miiRNA targets
| Gene ID | Expection | Align sequence(miRNA-target) | Annotation |
|---|
| CRO_T007652 | 2.5 | | | ncRNA: | 24 | AGAUGUGUAAAUAUUUCUCUGGAA | 1 | | | | | |||=||||||||||||||||||** | | | | targets: | 10347 | UCUGCACAUUUAUAAAGAGACCCC | 10370 |
| microtubule-associated proteins 70-4 |
| CRO_T011188 | 0 | | | ncRNA: | 24 | AGAUGUGUAAAUAUUUCUCUGGAA | 1 | | | | | |||||||||||||||||||||||| | | | | targets: | 487 | UCUACACAUUUAUAAAGAGACCUU | 510 |
| hypothetical protein |
| CRO_T012625 | 1 | | | ncRNA: | 24 | AGAUGUGUAAAUAUUUCUCUGGAA | 1 | | | | | |*|||||||||||||||||||||* | | | | targets: | 1081 | UAUACACAUUUAUAAAGAGACCUC | 1104 |
| DUF4033 domain containing protein |
| CRO_T014132 | 2.5 | | | ncRNA: | 24 | AGAUGUGUAAAUAUUUCUCUGGAA | 1 | | | | | ||||||*|||||||||||||||*| | | | | targets: | 6692 | UCUACAAAUUUAUAAAGAGACCCU | 6715 |
| laccase |
| CRO_T017018 | 2.5 | | | ncRNA: | 24 | AGAUGUGUAAAUAUUUCUCUGGAA | 1 | | | | | ||*|||||||||||||||||||** | | | | targets: | 222 | UCCACACAUUUAUAAAGAGACCCC | 245 |
| hypothetical protein |
| CRO_T033367 | 2.5 | | | ncRNA: | 24 | AGAUGUGUAAAUAUUUCUCUGGAA | 1 | | | | | ||||||||||||||||||||||** | | | | targets: | 1954 | UCUACACAUUUAUAAAGAGACCCC | 1977 |
| WRKY DNA-binding protein |
Expression profilings
