cro-novel-21's details annotation
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein
This network produced by cytoscapeweb

Module annotation (GSEA enrichment result)

Function AnnotationFDRGene Ontolog
protein transport0.001477978GO:0015031
Protein export 0.001418859KEGG

miiRNA targets

Gene IDExpectionAlign sequence(miRNA-target)Annotation
CRO_T0050732.5
 ncRNA:24AAGAUCGGUAUUACGUGUCAGUUA1
   *|*|=||*||||||||||||||*| 
 targets:7351AUGUGGCGAUAAUGCACAGUCAUU7374
SecY protein transport family protein

Expression profilings


Show more details about the miRNA target expression profiles
TOP