sly-miR1919c-3p's network
Export  
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein
This network produced by cytoscapeweb

Module annotation (GSEA enrichment result)

Function AnnotationFDRGene Ontolog
Phosphonate and phosphinate metabolism0.002016938KEGG
diacylglycerol biosynthesis (PUFA enrichment in oilseed)0.001232793plantCyc
phosphatidylcholine biosynthesis I0.001232793plantCyc
phosphatidylethanolamine biosynthesis II0.001318472plantCyc
phosphatidylcholine biosynthesis II0.003727315plantCyc
choline biosynthesis III0.005203152plantCyc
urea degradation II0.018313388plantCyc
superpathway of allantoin degradation in plants0.018313388plantCyc

miiRNA targets

Gene IDExpectionAlign sequence(miRNA-target)Annotation
Solyc04g010000.22
 ncRNA:21GGACAGUGUCUACUGAGAGCA1
   **||||||||||||=|*|||| 
 targets:1906GGUGUCACAGAUGAUUAUCGU1926
RNA-binding (RRM/RBD/RNP motifs) family protein
Solyc04g010020.22
 ncRNA:21GGACAGUGUCUACUGAGAGCA1
   **||||||||||||=|*|||| 
 targets:1773GGUGUCACAGAUGAUUAUCGU1793
RNA-binding (RRM/RBD/RNP motifs) family protein

4.Expression profilings


Show details about miRNA target functional module gene expression profiling
TOP