miRNA detailed information
miRNA detail image
Location informaition
Type | ID | Scaffold | Start | End | Strand |
---|---|---|---|---|---|
mature | cro-novel-43 | scaffold_3052943 | 11038 | 11058 | + |
precursor | cro-NOVEL-43 | scaffold_3052943 | 10944 | 11069 | + |
Sequence and structure information
Mature sequence[cro-novel-43] UAUACUGUCAUCUAUGUCCUC | |
Stem-loop sequence[cro-NOVEL-43] CCAGUUAAGUAGAGGACAUAGAUGACAAUAUAGUACACAAACUGAUGUUGUUUUGAUUAGGUAGUUUUUGAAUUAUAUGCGCAUUUUCAAGUACUAUACUGUCAUCUAUGUCCUCUGCUUAACUGA | |
Secondary structure of stem-loop sequence
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRO_T033375 |
| DHBP synthase RibB-like alpha/beta domain | 2.5 | psRNATarget[Detail] |
Expression pattern
Tissue | Treat | FPKM value |
---|---|---|
seedling | control | 33.08 |
seedling | MeJA treatment 1h | 20.18 |
seedling | MeJA treatment 8h | 94.16 |
seedling | MeJA treatment 24h | 145.14 |